GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

BACH1
BTB domain and CNC homolog 1

Gene
Official SymbolBACH1
Official Full NameBTB domain and CNC homolog 1
CGNC ID11810
also known astranscription regulator protein BACH1|BTB and CNC homology 1, basic leucine zipper transcription factor 1, Transcription regulator protein BACH1, BTB and CNC homolog 1, HA2303
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_416696
PolypeptideXP_416696
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.13932
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human571ENSG00000156273MIM:602751
Mouse12013ENSMUSG00000025612All phenotypic alleles (5):Targeted, knock-out(3) Targeted, other(2) MGI:894680
Xenopus100125783957115
Zebrafish553688ENSDARG00000002196ZDB-GENE-050522-220ZFIN:ZDB-GENE-050522-220
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene418488
Ensembl GeneENSGALG00000015828
KEGGgga:418488
GEISHA IdChEST214i4Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
TCAGCAGGAGAGAAAGGGAGCGGGGAAAGGAAACGGAGAGAGGCGGCGGCGGTGCTGCCCACCGGCCGCCCGCCCGGCC
CGCGGCTGAGGGGCGGCGGCGGCAACAGAAGCGCTGAGATTGGAAAAATAGAAGCATGCTTTCCACTGAGGCTTATGCT
AACATCTGTGATACAGAATGTCTCTAAGTGAGAAGAACAGCGTGGTTTTTGCATACGAGTCTTCAGTACACAGTACCAA
TGTACTTCTCAGTCTCGATGATCAGAGAAAGCAAGATATTCTTTGTGATGTCACTATTTTAGTGGAAGACCAGCGATTT
CGGGCTCACAAAGCTGTGCTTGCAGCTTGCAGTAGTTACTTCCTTTCAAGAATTGTGGGCCAGTTGGATGCTGATCTTA
TCATCACTTTACCAGAAGAGGTAACACTTAAAGGATTTAGTCCCTTGCTTCAGTTTGCATACACAGCTAAGCTTATTTT
AAATAAAGACAACGTGTCTGAAGTTTGCAAGTGTGCTGAATTCTTGGGCGTACGGAACATTGAAGAGTCTTGCTTTCAG
TTTCTCAAATTCAAATTTTTGGACTGTAAATCAGATCAAGAGTGTCCTAGGAAGAAATGCTGCACGCAGCATTGCAGGA
AAGTAAACCCTAAGATTAGCAGCGTGGATGATGGAGACTTAGAAATAGATGATGAAGCAGAAGAACTTATAGAAAAAGA
GTATATTCAAACCTCTCACACAAAGCTCTGTAAAGATGATGAAAATGCTAAAGCATCACCTGCCCTTCAAGATAATACC
AACCCAACCTCAAATCCTATGCATTTAGAAAAAGGCAATGTTTCCAGCTCATCTTCCCAGTGCCCC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 17
Widespread Expression
 
19-24
stage 20
stage 21
stage 22
stage 23
stage 24
Leg Mesenchyme
Paraxial Mesoderm
Pharyngeal Arches and Clefts
Widespread Expression
Wing Mesenchyme
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.13932

Mouse

EmageMGI:894680
EurexpressMGI:894680
MGI GXDMGI:894680

Frog

Xenbase957115

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-050522-220
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona