GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

AHR
aryl hydrocarbon receptor

Gene
Official SymbolAHR
Official Full Namearyl hydrocarbon receptor
CGNC ID8232
also known asaryl hydrocarbon receptor
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204118
PolypeptideNP_989449
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.3264
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human196ENSG00000106546MIM:600253
Mouse11622ENSMUSG00000019256All phenotypic alleles (14):Other(4) Targeted, knock-out(2) Targeted, other(8) MGI:105043
Xenopus613065, 398659983106
Zebrafish554265, 246224ENSDARG00000023537, ENSDARG00000020046ZDB-GENE-050922-1, ZDB-GENE-020531-2ZFIN:ZDB-GENE-050922-1, ZFIN:ZDB-GENE-020531-2
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene373907
Ensembl Gene
KEGGgga:373907

Entry 1

GEISHA IdChEST258o19Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
NNTGGGCGATTGGAGCTCCACCGCGGTGGCGGCCGCGGGCTAGCACCACCTTATGCATGTAGGCAAGAATTTGTTCCTT
ACAAGCAACCCACAGCAATGATGCCTCAGCTTTCTAACTTTTCCCAAATGGATTTCCCTGTAGCAGGTCTTGACAGATC
AGCCTATTCTGCTTCTTCCAACTTGGAGGATTTTCTCGGTTGTTTGCAGCAGGTCCCTGAAAACCTTGACTGTGGGATA
AATTCTGAGTCGGTTATGTTAACCCCCCAAACATGTTATGCAGGTGCCGTTTCTATGTACCAGTGCACACAAGAAGCA
CommentsAHR : No specific expression detected for stages 3-12.
no images

Entry 2

GEISHA IdAHR.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerAAGACGGGTGAGAGTGGAATGAC
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGGACGGGTTGAAGATGTGTGGCAGcDNA Template Length
Forward cDNA Template Probeshow
ATACTTATCACATCTAACTGAGAGGGATATGCTTCATTTACATTTCCTCCATTGAAGCCATTTTGGAACTTGTTTAACA
ATGTTTGCTGATTTGCCATCATGGGATCATATTGCATTTGATCCATGCAGTTTGGCTGTGCTTCTTGTGTGCACTGGTA
CATAGAAACGGCACCTGCATAACATGTTAGGGGGGTTATCATATCCGACTCAGAATTTATCCCACAGTCTAGGTTTTCA
GGGACAAGCTGCAAACAACCAATAAAATCCTCTAAGTTGGAAGAAGCAGAATAGGCTGATCTGTCAAGACCTGCTACAG
GGAAATCCATTTGGGAAAAGTTAGAAAGCTGAGGCATCATTGCTGTGGGTTGCTTGTATGGAACAAATTCTTGCCTACA
TGCATAAGGTGAAGCGTTTACTTCTGATTTGTAAGAAAACTCAGCAGCAGTGGCTTGCATGCCAGGGAACGTGTATTGC
TGGGGCTGCTGCGGTGAGCAAAGAGGCATGCTGGTGCCAGAGCTCCAATTTGTGAACATCCCATTGACTTGCATATGTT
TCATTTTCTGACAGAGCTGCTGCTGTTGCTGTTGCTGCTGCTCCATGAGCTGTTTCTGATGCTGATGAATTTGATGCTG
ATCTAATTCTTGCTGTACCAAGCAACCGGCATTCTGGACCAGGGGCTGCTGCTGATTACAGCCCGAATATAAGAAGTCA
GACTTATTTAAGGAATCCTGCACATAAGTCAAGATTTCATCAGTTATGTCGATGTCCCCAATATCATCCATACCAGATA
ATTCAGTTTTAAAAACTCCTCATCCTGCTGAATACACTTTAAATCTTCAAAGTCAATACCCAGATTTTTCATGATGCTG
TACAAATCATTTGTTTTGTTATCTTGAAAAACCCTGCATTTCCTCCAGAAATGGCCACTACTGTCCTGGGAAACCTCCA
TAAATTCCGGCTTGAAATATTGGAACTTCCGCCGGTAGGAAGCATCTGTCCATTCACTGCCTAAAAACCCCCCANTTCA
TCCTGCTGTCTGAAAAAATTCCCTCAAGAAAATTTTGTTAATCTGAAGAAAAAAAAAAAACACCTCTTCCTTAAATGGC
CCAGGAGAATTGGACCCCAAACCCCAGAAGGGATTTTCCCCTTTCCCGGGGGTTTTCCCTGGCGAAAGACCCAAACCGG
AACAAGAATTTACTTTAAAACCCCCCCGGGAAAAAGAAGAACCACGACCCCCCGAAATTCCCTCTTTCTGAAAGCTTTG
GAAAAAAA
CommentsNo specific expression detected stages 3-12.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 18
Allantois
Cranial Ganglia
Spinal Ganglia and Nerves
 
19-24
stage 20
stage 21
Allantois
Cranial Ganglia
Head Mesenchyme
Lung
Retina
Somites
Spinal Ganglia and Nerves
 
25
stage 25
Allantois
Cranial Ganglia
Head Mesenchyme
Leg Ectoderm
Lung
Retina
Spinal Ganglia and Nerves
Wing Ectoderm
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.3264

Mouse

EmageMGI:105043
EurexpressMGI:105043
MGI GXDMGI:105043

Frog

Xenbase983106

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-050922-1, ZDB-GENE-020531-2
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona