GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

SALL1
spalt like transcription factor 1

The human orthologue of this gene is associated
with the following human diseases:
Gene
Official SymbolSALL1
Official Full Namespalt like transcription factor 1
CGNC ID49323
also known asSAL1, Spalt, sal-like protein 1|sal-like 1|spalt 1|transcription factor Spalt, sal-like 1, csal-1, SALL1
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204707
PolypeptideNP_990038
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.1817
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly34568FBgn0000287
Human6299ENSG00000103449MIM:107480MIM:602218
Mouse58198ENSMUSG00000031665All phenotypic alleles (10):Targeted, knock-out(4) Targeted, other(6) MGI:1889585
Xenopus100036618, 379679, 100337600491392
Zebrafish555721, 170966ENSDARG00000074319ZDB-GENE-020228-2, ZDB-GENE-020228-3ZFIN:ZDB-GENE-020228-2, ZFIN:ZDB-GENE-020228-3
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395446
Ensembl Gene
KEGGgga:395446
GEISHA Idcsal1.Sweetman.2005Data SourcePublication
Complete cDNA Template Probeshow
TTCTGTGCTAAAGTGTTTGGGAGTGACAGTGCCTTGCAGATTCATTTACGTTCTCACACTGGCGAGAGGCCATTTAAAT
GCAACATATGTGGAAACAGGTTCTCCACAAAGGGAAACTTAAAAGTCCACTTTCAGCGGCATAAAGAAAAATATCCTCA
TATTCAGATGAATCCGTACCCAGTGCCAGAGCATTTGGACAATATTCCTACAAGCACGGGTATTCCTTATGGGATGTCT
ATACCGCCAGAGAAGCCTGTCACGAGCTGG
CitationSweetman D, Smith TG, Farrell ER, Münsterberg A. Expression of csal1 in pre limb-bud chick embryos. Int J Dev Biol. 2005;49(4):427-30.
Copyright"Reprinted from Int. J. Dev. Biol., 49, Sweetman D, Smith TG, Farrell ER, Münsterberg A, Expression of csal1 in pre limb-bud chick embryos, 427-30, Copyright (2005), with permission from Copyright © 2005 UBC Press". All rights reserved.
CommentsThe EMBL/GenBank accession number of csal1 given in the paper is: AF288697. According to the authors referenced: Primer sequences used to isolate the probe template corresponded to the following amino acid residues: FCAKVFG (5'-TTYTGYGCIAARGTITTYGG-3') and EKPVTTW (antisense, 5'-CCAIGTIGTIACIGGYTTYTC-3').
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Hensen's Node
 
4-6
stage 5
stage 6
Head Process
Headfold
Hensen's Node
Neural Plate/Tube
Notochord
 
7-12
stage 7
stage 10
stage 12
stage 12
Ectoderm
Endoderm
Headfold
Heart Tube
Hensen's Node
Neural Plate/Tube
Notochord
Oral Pharynx
Paraxial Mesoderm
Pharynx
Sinus Venosus
Somites
Surface Ectoderm
Stomadeum
13-16
stage 14
stage 14
stage 16
stage 16
Endoderm
Paraxial Mesoderm
Pharynx
Sinus Venosus
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.1817

Mouse

EmageMGI:1889585
EurexpressMGI:1889585
MGI GXDMGI:1889585

Frog

Xenbase491392

Fruit Fly

BDGPFBgn0000287

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-020228-2, ZDB-GENE-020228-3
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona