Quick Search
X XI XII XIII XIV 1 2 3 4 5 6 7 8 9 10 11 12
13 14 15 16 17 18 19 20 21 22 23 24
25 26 27 28 29 30 31 32 33 34 35 36
37 38 38 40 41 42 43 44
Gene Family QuickSearch
Human Disease Gene Search
SLC6A2 The human orthologue of this gene is associated
Gene Summary Expression Transcript Levels Other Species Expression JBrowse Gene Official Symbol SLC6A2 Official Full Name solute carrier family 6 member 2 CGNC ID 49331 also known as sodium-dependent noradrenaline transporter|norepinephrine transporter|solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 gene type protein-coding
Genomic Map Sequence Information Gene Expression Orthology Gene Ontology Molecular Function Biological Process Cellular Component
Links to other databases
GEISHA Id NET.Apostolova.2007 Data Source Publication Complete cDNA Template Probe show GCACGAGCCGGAGTGGCAGAAGCCAGAAGAAGGAATTCCCCTTCCATCACCTGCCCCTGCACACAGGTACCAAAGAATG
Citation Apostolova G, Dorn R, Ka S, Hallböök F, Lundeberg J, Liser K, Hakim V, Brodski C, Michaelidis TM, Dechant G. Neurotransmitter phenotype-specific expression changes in developing sympathetic neurons. Mol Cell Neurosci. 2007 Jul;35(3):397-408. Epub 2007 Apr 1. Copyright Copyright © 2007 Elsevier Inc. All rights reserved. Comments As insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI NM_204716.1
Stage Image (click image to view full size) Location (click to highlight) Comments (click to highlight) 31-44
stage 44
stage 44
Spinal Ganglia and Nerves
Data from NCBI Unigene EST ProfileGga.249
Mouse Frog Fruit Fly Zebra Finch Zebrafish
