GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

SMAD9
SMAD family member 9

The human orthologue of this gene is associated
with the following human disease:
Gene
Official SymbolSMAD9
Official Full NameSMAD family member 9
CGNC ID12809
also known asSMAD8, mothers against decapentaplegic homolog 9|SMAD, mothers against DPP 8|SMAD, mothers against DPP homolog 9|TGF-beta signal transducer Smad8, Smad8 , Smad9, MAD, mothers against decapentaplegic homolog 9, MAD, mothers against decapentaplegic homolog 8
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001024826
PolypeptideNP_001019997
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.293
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human4093ENSG00000120693MIM:178600MIM:603295
Mouse55994ENSMUSG00000027796All phenotypic alleles (10):Targeted, knock-out(4) Targeted, other(6) MGI:1859993
Xenopus493210, 379659484685
Zebrafish445564ENSDARG00000021938ZDB-GENE-031014-1ZFIN:ZDB-GENE-031014-1
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395543
Ensembl GeneENSGALG00000017050
KEGGgga:395543

Entry 1

GEISHA IdSmad8.Shin.2006Data SourcePublication
Complete cDNA Template Probeshow
CTTACCCAGCCACATGTTCTCCCAGTCGCCTAACAGCATCAGCTACCCCAACTCACCAGGAAGCTCTTCTGGACCAGGA
AGTCCATATCAGCTCACGGTGGAAACTCCACCCCCACCCTACCACGCAAGAGAAACTCCAGGAAGCCACAATGGGCGGT
CAATGGATGCTATAGCTGAAAGCCAACTAGTACTGTCTTTGCCCAATGGAGGTAAATCTGCCGATGGAGAAACTGAAAA
TTTTCGGCCTGTTTGCTATGAGGAACCACAACACTGGTGCTCAGTTGCCTACTATGAACTCAACAACAGGGTAGGAGAG
ACTTTCCAGGCTTCCTCTCGAAGTATCCTTATAGATGGATTTACAGATCCCTCAAATAACAAAAACAGGTTCTGCCTGG
GACTGCTCTCGAATGTAAACCGCAATTCGACTATAGAAAACACCAGGAGACACATAGGAAAAGGTGTCCATCTTTATTA
TGTTGGTGGAGAAGTGTATGCTGAATGTGTCAGTGACAGCAGTATTTTCGTGCAGAGCCGCAATTGTAACTATCAGCAT
GGTTTCCACCCAGCCACTGTCTGTAAGATCCCCAGTGGCTGCAGCCTCAAGATCTTCAACAACCAGCTCTTCGCCCCAG
CTGCTTGCCCAGTCAGTCAATCATGGTTTTGAAGTGGTATATGAGCTGACGAAGATGTGTACGATTCGAATGAGCTTTG
TTAAAGGCTGGGGAGCAGAGTATCATCGCCAAGATGTTACAAGCACGCCCTGCTGGATTGAGATCCACCTGCACGGACC
AA
CitationShin M, Noji S, Neubüser A, Yasugi S. FGF10 is required for cell proliferation and gland formation in the stomach epithelium of the chicken embryo. Dev Biol. 2006 Jun 1;294(1):11-23. Epub 2006 Apr 17.
CopyrightReprinted from Developmental Biology, 294, Masahiron Shin, Sumihare Noji, Annette Neubüser, and Sadao Yasugl, 11-23, Copyright 2006, with permission from Elsevier. Copyright © 2005 Elsevier Inc. All rights reserved.
CommentsSmad8 and Smad9 map as one gene in chick at this time.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-43
stage 32
stage 36
stage 37
stage 43
Stomach
Anatomy.
proventriculus

Entry 2

GEISHA IdSmad8.Shin.2005Data SourcePublication
Complete cDNA Template Probeshow
CTCTGCTTCTTATGCACTCCAGCACCCCTATCAGTTCCTTGTTCTCCTTCACCAGCCCTGCAGTGAAAAGGCTGCTGGG
CTGGAAACAAGGAGATGAAGAGGAAAAGTGGGCAGAAAAAGCTGTTGATTCCCTGGTGAAGAAATTAAAGAAGAAAAAA
GGTGCCATGGAAGAACTGGAAAGGGCTCTAAGCTGCCCAGGTCAGCCCAGTAAATGTGTCACGATCCCACGTTCCTTGG
ATGGGCGGCTGCAGGTTTCTCACCGCAAGGGGCTCCCTCATGTCATATACTGCAGAGTGTGGCGTTGGCCTGATTTACA
ATCTCACCATGAATTGAAGCCACTGGAATGCTGTGAGTTCCCATTTGGCTCAAAACAGAAAGAAGTGTGCATTAACCCC
TACCATTACCGGCGGGTGGAAACTCCAGTCCTACCTCCAGTACTTGTTCCAAGACACAGCGAGTTTAACCCTCACCTCA
GCCTTCTCGCCAAGTTTCGAAATACTTCTCTGCACAGTGAGCCACTGATGCCACACAATGCCACCTATCCTGATTCTTT
CCAACATCCTCCATGCACCCCGTTTCCACCATCACCCAGCCACATGTTCTCCCAGTCGCCTAACAGCATCAGCTACCCC
AACTCACCAGGAAGCTCTTCTGGACCAGGAAGTCCATATCAGCTCACGGTGGAAACTCCACCCCCACCCTACCACGCAA
GAGAAACTCCGGGAAGCCACAATGGGCGGTCAATGGATGCTATAGCTGAAAGCCAACTAGTACTGTCTTTGCCCAATGG
AGGTAAATCTGCCGATGGAGAAACTGAAAATTTTCGGCCTGTTTGCTATGAGGAGCCACAACACTGGTGCTCAGTTGCC
TACTATGAACTCAACAACAGGGTAGGAGAGACTTTCCAGGCTTCCTCTCGAAGTATCCTTATAGATGGATTTACAGATC
CCTCAAATAACAAAAACAGGTTCTGCCTGGGACTGCTCTCGAATGTAAACCGCAATTCGACTATAGAAAACACCAGGAG
ACACATAGGAAAAGGTGTCCATCTTTATTATGTTGGTGGAGAAGTGTATGCTGAATGTGTCAGTGACAGCAGTATTTTC
GTGCAGAGCCGCAATTGTAACTATCAGCATGGTTTCCACCCAGCCACTGTCTGTAAGATCCCCAGTGGCTGCAGCCTCA
AGATCTTCAACAACCAGCTCTTCGCCCAGCCGCTTGCCCAGTCAGTCAATCATGGTTTTGAAGTGGTATATGAGCTGAC
GAAGATGTGTACGATTCGAATGAGCTTTGTTAAAGGCTGGGGAGCAGAGTATCATCGCCAAGATGTTACAAGCACGCCC
TGCTGGATTGAGATCCACCTGCACGGACCATTGCAATGGCTGGATAAGGTTCTGACACAGATGGGCTCACCTCATAACC
CCATCTCTTCCGTCTCTTAAGAATCATCTCTA
CitationShin M, Watanuki K, Yasugi S (2005). Expression of Fgf10 and Fgf receptors during development of the embryonic chicken stomach. Gene Expr Patterns. 2005 Apr;5(4):511-6.
CopyrightCopyright © 2004 Elsevier B.V. All rights reserved.
CommentsAccording to authors, "cSmad8, cGata4, cFgf10 (a gift from Dr T. Nohno; Ohuchi et al., 1997). As information provided was insufficient to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #AY953145).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 27
stage 29
stage 30
Gut
Unlabeled
Presumptive glandular epithelium of the proventriculus
31-39
stage 36
stage 39
Gut
Presumptive glandular epithelium of the proventriculus
all
 
 
  

Entry 3

GEISHA IdSmad8.Zuzarte.2004Data SourcePublication
Complete cDNA Template Probeshow
AGGTGCCATGGAAGAACTGGAAAGGGCTCTAAGCTGCCCAGGTCAGCCCAGTAAATGTGTCACGATCCCACGTTCCTTG
GATGGGCGGCTGCAGGTTTCTCACCGCAAGGGGCTCCCTCATGTCATATACTGCAGAGTGTGGCGTTGGCCTGATTTAC
AATCTCACCATGAATTGAAGCCACTGGAATGCTGTGAGTTCCCATTTGGCTCAAAACAGAAAGAAGTGTGCATTAACCC
CTACCATTACCGGCGGGTGGAAACTCCAGTCCTACCTCCAGTACTTGTTCCAAGACACAGCGAGTTTAACCCTCACCTC
AGCCTTCTCGCCAAGTTTCGAAATACTTCTCTGCACAGTGAGCCACTGATGCCACACAATGCCACCTATCCTGATTCTT
TCCAACATCCTCCATGCACCCCGTTTCCACCATCACCCAGCCACATGTTCTCCCAGTCGCCTAACAGCATCAGCTACCC
CAACTCACCAGGAAGCTCTTCTGGACCAGGAAGTCCATATCAGCTCACGGTGGAAACTCCACCCCCACCCTACCACGCA
AGAGAAACTCCGGGAAGCCACAATGGGCGGTCAATGGATGCTATAGCTGAAAGCCAACTAGTACTGTCTTTGCCCAATG
GAGGTAAATCTGCCGATGGAGAAACTGAAAATTTTCGGCCTGTTTGCTATGAGGAGCCACAACACTGGTGCTCAGTTGC
CTACTATGAACTCAACAACAGGGTAGGAGAGACTTTCCAGGCTTCCTCTCGAAGTATCCTTATAGATGGATTTACAGAT
CCCTCAAATAACAAAAACAGGTTCTGCCTGGGACTGCTCTCGAATGTAAACCGCAATTCGACTATAGAAAACACCAGGA
GACACATAGGAAAAGGTGTCCATCTTTATTATGTTGGTGGAGAAGTGTATGCTGAATGTGTCAGTGACAGCAGTATTTT
CGTGCAGAGCCGCAATTGTAACT
CitationZuzarte-Luís V, Montero JA, Rodriguez-León J, Merino R, Rodríguez-Rey JC, Hurlé JM. A new role for BMP5 during limb development acting through the synergic activation of Smad and MAPK pathways. Dev Biol. 2004 Aug 1;272(1):39-52.
CopyrightReprinted from Developmental Biology, Volume 272, Issue 1, V Zuzarte-Luıs, J.A. Montero, J Rodriguez-León, R Merino, J.C Rodrıguez-Rey, and J.M Hurlé, A new role for BMP5 during limb development acting through the synergic activation of Smad and MAPK pathways, Pages 39-52, Copyright 2004, with permission from Elsevier. Copyright © 2004 Elsevier B.V. All rights reserved.
CommentsFragments of chicken ... Smad8 (972 bp) genes were obtained by RT-PCR. cSmad8, 5′-AGGTGCCATGGAAGAACTGG-3′(sense) and 5′-AGTTACAATTGCGGCTCTGC-3′ (antisense).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-28
stage 28
Leg Mesenchyme
Wing Mesenchyme
 

Entry 4

GEISHA IdSMAD8.LeDréau.2012Data SourcePublication
Complete cDNA Template Probeshow
CTCTGCTTCTTATGCACTCCAGCACCCCTATCAGTTCCTTGTTCTCCTTCACCAGCCCTGCAGTGAAAAGGCTGCTGGG
CTGGAAACAAGGAGATGAAGAGGAAAAGTGGGCAGAAAAAGCTGTTGATTCCCTGGTGAAGAAATTAAAGAAGAAAAAA
GGTGCCATGGAAGAACTGGAAAGGGCTCTAAGCTGCCCAGGTCAGCCCAGTAAATGTGTCACGATCCCACGTTCCTTGG
ATGGGCGGCTGCAGGTTTCTCACCGCAAGGGGCTCCCTCATGTCATATACTGCAGAGTGTGGCGTTGGCCTGATTTACA
ATCTCACCATGAATTGAAGCCACTGGAATGCTGTGAGTTCCCATTTGGCTCAAAACAGAAAGAAGTGTGCATTAACCCC
TACCATTACCGGCGGGTGGAAACTCCAGTCCTACCTCCAGTACTTGTTCCAAGACACAGCGAGTTTAACCCTCACCTCA
GCCTTCTCGCCAAGTTTCGAAATACTTCTCTGCACAGTGAGCCACTGATGCCACACAATGCCACCTATCCTGATTCTTT
CCAACATCCTCCATGCACCCCGTTTCCACCATCACCCAGCCACATGTTCTCCCAGTCGCCTAACAGCATCAGCTACCCC
AACTCACCAGGAAGCTCTTCTGGACCAGGAAGTCCATATCAGCTCACGGTGGAAACTCCACCCCCACCCTACCACGCAA
GAGAAACTCCGGGAAGCCACAATGGGCGGTCAATGGATGCTATAGCTGAAAGCCAACTAGTACTGTCTTTGCCCAATGG
AGGTAAATCTGCCGATGGAGAAACTGAAAATTTTCGGCCTGTTTGCTATGAGGAGCCACAACACTGGTGCTCAGTTGCC
TACTATGAACTCAACAACAGGGTAGGAGAGACTTTCCAGGCTTCCTCTCGAAGTATCCTTATAGATGGATTTACAGATC
CCTCAAATAACAAAAACAGGTTCTGCCTGGGACTGCTCTCGAATGTAAACCGCAATTCGACTATAGAAAACACCAGGAG
ACACATAGGAAAAGGTGTCCATCTTTATTATGTTGGTGGAGAAGTGTATGCTGAATGTGTCAGTGACAGCAGTATTTTC
GTGCAGAGCCGCAATTGTAACTATCAGCATGGTTTCCACCCAGCCACTGTCTGTAAGATCCCCAGTGGCTGCAGCCTCA
AGATCTTCAACAACCAGCTCTTCGCCCAGCCGCTTGCCCAGTCAGTCAATCATGGTTTTGAAGTGGTATATGAGCTGAC
GAAGATGTGTACGATTCGAATGAGCTTTGTTAAAGGCTGGGGAGCAGAGTATCATCGCCAAGATGTTACAAGCACGCCC
TGCTGGATTGAGATCCACCTGCACGGACCATTGCAATGGCTGGATAAGGTTCTGACACAGATGGGCTCACCTCATAACC
CCATCTCTTCCGTCTCTTAAGAATCATCTCTA
CitationLe Dréau G, Garcia-Campmany L, Rabadán MA, Ferronha T, Tozer S, Briscoe J, Martí E. Canonical BMP7 activity is required for the generation of discrete neuronal populations in the dorsal spinal cord. Development. 2012 Jan;139(2):259-68.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # AY953145.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 18
stage 18
Neural Plate/Tube
floor plate
19-24
stage 24
Neural Plate/Tube
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.293

Mouse

EmageMGI:1859993
EurexpressMGI:1859993
MGI GXDMGI:1859993

Frog

Xenbase484685

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-031014-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona