GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

PDLIM4
PDZ and LIM domain 4

The human orthologue of this gene is associated
with the following human disease:
Gene
Official SymbolPDLIM4
Official Full NamePDZ and LIM domain 4
CGNC ID5048
also known asRIL, PDZ and LIM domain protein 4|LIM protein RIL|reversion-induced LIM protein, PDZ and LIM domain protein 4, LIM protein RIL, Reversion-induced LIM protein
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204839
PolypeptideNP_990170
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.7467
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human8572ENSG00000131435MIM:166710MIM:603422
Mouse30794ENSMUSG00000020388All phenotypic alleles (3):Targeted, other(3) MGI:1353470
Xenopus394862, 4469691001789
Zebrafish569404ENSDARG00000068973ZDB-GENE-070308-5ZFIN:ZDB-GENE-070308-5
Gene Ontology
Molecular Functionzinc ion binding
Biological Process
Cellular Component
Links to other databases
Entrez Gene395643
Ensembl Gene
KEGGgga:395643
GEISHA Idpgn1c.pk018.f9Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
AGCGGAGCGCAGCGCTGGGCACGGAGCCCCAACCCCGCTATGCCGCACTCGGTGGCCCTGCGCGGCCCCTCGCCGTGGG
GTTTCCGCCTGGTGGGCGGTAAGGACTTCAGCACGCCGCTGACCATCTCCAGGATTAACCCTGGAAGTAAAGCAGCCCT
GGCCAACCTGTGCCCAGGAGACATCATTCTGGCCATTA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
stage 6
stage 6
Hensen's Node
Neural Plate/Tube
node asymmetry
7-12
stage 8
stage 9
stage 10
stage 12
Anterior Intestinal Portal
Ear/Otic Placcode
Head Mesenchyme
Neural Plate/Tube
Notochord
Primitive Streak
Somites
 
13-18
stage 14
stage 16
stage 17
stage 17
stage 17
stage 17
stage 18
stage 18
Diencephalon
Ear/Otic Placcode
Eye
Foregut
Lens
Myotome
Nasal Placcode/Nerve
Paraxial Mesoderm
Pharyngeal Arches and Clefts
Retina
Sclerotome
Somites
Splanchnic Mesoderm
Stomach
Tail
hand transected
19-23
stage 20
stage 20
stage 21
stage 21
stage 21
stage 21
stage 22
stage 22
stage 22
stage 22
stage 23
stage 23
Allantois
Dermomyotome
Diencephalon
Ear/Otic Placcode
Eye
Forebrain
Hindbrain
Lens
Limb Buds
Midbrain
Myotome
Nasal Placcode/Nerve
Paraxial Mesoderm
Pharyngeal Arches and Clefts
Sclerotome
Somites
Spinal Cord
Splanchnic Mesoderm
Tail
Wing
Wing Mesenchyme
xs
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.7467

Mouse

EmageMGI:1353470
EurexpressMGI:1353470
MGI GXDMGI:1353470

Frog

Xenbase1001789

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-070308-5
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona