GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

OVOL2
ovo like zinc finger 2

Gene
Official SymbolOVOL2
Official Full Nameovo like zinc finger 2
CGNC ID6606
also known asOVOL3, transcription factor Ovo-like 2|ovo like zinc finger 3|ovo-like 2, Transcription factor Ovo-like 2, hOvo2, Zinc finger protein 339
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_415018
PolypeptideXP_415018
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.20279
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human58495ENSG00000125850
Mouse107586ENSMUSG00000037279All phenotypic alleles (2):Targeted, knock-out(1) Targeted, other(1) MGI:1338039
Xenopus448478854192
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene416720
Ensembl Gene
KEGGgga:416720

Entry 1

GEISHA IdChEST525i12Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
CCCAGGCGGCCTCGGCTGCGCCCCGGGCTACGAAGACAGCTGCAGCCTGGAGAGCAGCGGCAGCAGCGGGACGCGGGAC
CCCGAGCTCGGAGACCCCCCCACGCCGCAGGCGGCCCCCGCGGAGCTGGGCGCGCCCGGGGGGATGCTGCTGGACCTGG
CCGTCAGGCGCCCCGCCGTCAGGTCGAAAATCAAGTTCACCACGGGCACCTGCACCGATGCCGCAGTGCACTCCTGCGA
GCTGTGTGGCAAGGGCTTCCGCCTGCAGCGCATGCTGAACCGGCACGTCAAGTGCCACAGCCAGGTGAAGAGGCACCTG
TGCACCTTCTGCGGGAAGGGCTTCAACGACACCTTTGATCTGAAGCGCCACGTCCGGACCCACACCGGAATTCGTCCTT
ACAAATGTGAGGTTTGCAACAAAGCATTTACCCAGCGGTGTTCCCTGGAATCCCACCTCAAGAAGATTCACGGAGTGCA
GCAGCAATACGCCTACAAACAGAGGCGAGACAAACTGTACGTGTGCGAGGATTGCGGCTACACCGGCCCCACGCAGGAG
GACCTGTACCTGCATGTCAGCAGCGTTCACCCCAGCAGTGCTTTCCTGAAAAAAACCTCAAAAAAACTCGCAGCGGTTT
TGCAAAACAAACTGAGCCCTGTCCTGCAGAGGAACTCCAAAGATGACGACAAAGATGAGTAACGCGGTGGATTACAGTG
GTCTACAGGAATGAAGTTTACACGTAGGACTACGTATATATTATTTTTTTAAAAAACCTATTTTTGAATAGATCCCTGA
AAAAAAG
Commentsno specific expression detected stages 4-23.
no images

Entry 2

GEISHA IdOVOL2.Trevers.2023Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
CTGGAATCCCACCTCAAGAAGATTCACGGAGGTGCAGCAGCAATACGCCTACAAACAGAGGCGAGACAAACTGTACGTG
TGCGAGGATTGCGGCTACACCGGCCCCACGCAGGAGGACCTGTACCTGCATGTCAGCAGCGTTCACCCCAGCAGTGCTT
TCCTGAAAAAAACTTCAAAAAAAACTCGCAGCGGTTTTGCAAAACAAACTGAGCCCTGTCCTGCAGAGGAACTCCAAAG
ATGACGACAAAGATGAGTAACGCGGTGGATTACAGTGGTCTACAGGAATGAAGTTTACACGTAGGACTACGTATATATT
ATTTTTTTAAAAAACCTATTTTGAAATAGATCCCTGAAAGAAATGGGATACTTTTGTTAACAGGACTCTCTTGATATTG
GTAGAACCTCAACTTGAAAGAAATATTCCCAGAAATCATACAAACATAAGACTTTATCTGGTCAAAAATTGGACAGGCT
GGAAGAGGCTGTCATCTATGTGATGGAGTATTTACTGACCCTGGCATTCAGGTAACCTGACTGCCCTTTCAACTCTCCT
ACACATCTGAATGGCGCTGACAAACAAGCTTACCTTTCCCCGGCATGTTTCTTACAGACAGTAACAGTTACCTCCTGCA
GAAATTACTTTTGAGGGGTTGGGTGAACGGGGCCACATAAGAGCAGCTCCTAGCACACTGTTCTTAAGGTGGCAAATTA
GTTACAATTGGCTTACGAGCCGTACAAA
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Trevers et al. 2023.
no images
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.20279

Mouse

EmageMGI:1338039
EurexpressMGI:1338039
MGI GXDMGI:1338039

Frog

Xenbase854192

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona