GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

LOC417741
secreted frizzled-related protein 2-like

Gene
Official SymbolLOC417741
Official Full Namesecreted frizzled-related protein 2-like
CGNC ID50585
also known assecreted frizzled-related protein 5, similar to secreted Xwnt8 inhibitor sizzled
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_415985
PolypeptideXP_415985
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus733750, 398164482076
Zebrafish353294ZDB-GENE-030530-1ZFIN:ZDB-GENE-030530-1
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene417741
Ensembl GeneENSGALG00000008635
KEGGgga:417741

Entry 1

GEISHA IdSizzled.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTTATAAAAGCTTGCGGCCGCAGAATATACCAAATGTGTAGTGATACCCAAGG
Reverse cDNA Template PrimerGCTCTAGAAATTAACCCTCACTAAAGGTGAGTTTCATAAGGCAAGAGTGAGCcDNA Template Length641
Complete cDNA Template Probeshow
TTTATAAAAGCTTGCGGCCGCAGAATATACCAAATGTGTAGTGATACCCAAAGATGGACATGTGCCACGAGAATTGGGT
ACTCCGAAATGAGGCTTCCCAACCTGATGGGACACACAAGCATGGCAGAGGTCGTCCTAAAATCCACCACCTGGCAGCA
CCTGGTGCACACGGACTGTCACCCTCATGTGAGGATGTTCCTGTGCTCTCTGTTTGCACCCATCTGCCTGGACACGTTC
ATCCATCCCTGTAGGAGTATGTGTGTTGGTGTTCGGGACAGCTGTGCGCCTGTACTTGCCTGCCATGGGCACACCTGGC
CAGAAAGTCTGGACTGCAACCGGTTCCCTGCAGACGAGGACATGTGTCTGGCATCGCTTACAAAGGAATACAAATACTT
GCACAAAGTCCTACCGAAGCCTGCATGCCAGACCTGCCCAGCAGTGGAGGAACTCTTCACGCACAAAAGACTTCTCGAA
GTTTTCTGTGACAGTAATTTCGCAGTGAAAGTAAAGCTGTCCAAAAAAAGAGCAGTAATCGGCGACCAAGAGTACAGCA
TTGAGTGCCATGTGGAATTCATCCCAGGGCTCACTCTTGCCTTATGAAACTCACCTTTAGTGAGGGTTAATTTTCTAGA
GCAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Germinal Crescent
Lateral Plate Mesoderm
 
4-6
stage 5
stage 6
Germinal Crescent
Lateral Plate Mesoderm
 
7-12
stage 7
stage 8
stage 9
stage 10
stage 12
Anterior Intestinal Portal
Heart Tube
Lateral Plate Mesoderm
Tail
 
13-18
stage 15
stage 16
Anterior/Second Heart Field
Head Mesenchyme
Lateral Plate Mesoderm
Myocardium
Oral Pharynx
Outflow Tract
Pharyngeal Arches and Clefts
 
19-24
stage 21
stage 24
Allantois
Forebrain
Midbrain
Myocardium
Nasal Placode/Nerve
Outflow Tract
 

Entry 2

GEISHA IdSIZZLED.Alev.2010Data SourcePublication
Complete cDNA Template Probeshow
GTGCCACGAGATTGGGTACTCCGAAATGAGGCTTCCCAACCTGATGGGACACACAAGCATGGCAGAGGTCGTCCTAAAA
TCCACCACCTGGCAGCACCTGGTGCACACGGACTGTCACCCTCATGTGAGGATGTTCCTGTGCTCTCTGTTTGCACCCA
TCTGCCTGGACACGTTCATCCATCCCTGTAGGAGTATGTGCGTTGGTGTTCGGGACAGCTGCGCGCCTGTACTTGCCTG
CCATGGGCACACCTGGCCAGAAAGCCTGGACTGCAACCGGTTCCCTGCAGACGAGGACATGTGTCTGGCATCGCTTACA
AAGGAATACAAATACTTGCACAAAGTCCTACCGAAGCCTGCATGCCAGACCTGCCCAGCAGTGGAGGAACTCTTCACGC
ACAAAAGACTTCTTGAAGTTTTCTGTGACAGTAATTTCGCAGTGAAAGTAAAGCTGTCCAAAAAAAGAGCAGTAATCGG
CGACCAAGAGTACAGCATTGAATGCCATGTGGAATTCATTACCCAGGGCTCACTC
CitationAlev C, Wu Y, Kasukawa T, Jakt LM, Ueda HR, Sheng G. Transcriptomic landscape of the primitive streak. Development. 2010 Sep 1;137(17):2863-74. Epub 2010 Jul 28.
CopyrightPublished by The Company of Biologists 2010. This material is protected by a copyright retained by the authors. Permission granted by Dr. G Sheng.
CommentsThe probe for Sizzled was amplified by PCR using the following primers: Forward Primer: GTGCCACGAGATTGGGTACT Reverse Primer: GAGTGAGCCCTGGGTAATGA Base Pair Numbers: 162 - 690
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4
stage 4
stage 4
Area Opaca
 

Entry 3

GEISHA IdSzl.Wittler.2008Data SourcePublication
Complete cDNA Template Probeshow
GACAGCTCCCTGTTTGGCAAGCTGGGACTCACAGGGAGATGCTGTTGACTGCAAAAATACTTGTTTTCACTCTGAGTGT
TTTCCTAGGAGTGGGCACAAGTTTTGACATTGGATTATCCACCAAATGTGTAGTGATACCCAAGGAGATGGACATGTGC
CACGAGATTGGGTACTCCGAAATGAGGCTTCCCAACCTGATGGGACACACAAGCATGGCAGAGGTCGTCCTAAAATCCA
CCACCTGGCAGCACCTGGTGCACACGGACTGTCACCCTCATGTGAGGATGTTCCTGTGCTCTCTGTTTGCACCCATCTG
CCTGGACACGTTCATCCATCCCTGTAGGAGTATGTGCGTTGGTGTTCGGGACAGCTGCGCGCCTGTACTTGCCTGCCAT
GGGCACACCTGGCCAGAAAGCCTGGACTGCAACCGGTTCCCTGCAGACGAGGACATGTGTCTGGCATCGCTTACAAAGG
AATACAAATACTTGCACAAAGTCCTACCGAAGCCTGCATGCCAGACCTGCCCAGCAGTGGAGGAACTCTTCACGCACAA
AAGACTTCTCGAAGTTTTCTGTGACAGTAATTTCGCAGTGAAAGTAAAGCTGTCCAAAAAAAGAGCAGTAATCGGCGAC
CAAGAGTACAGCATTGAATGCCATGTGGAATTCATTACCCAGGGCTCACTCTTGCCTTATGAAACTCAGCACATGATAC
AGCAATGGCTGCTCATCAATGAAAACTGTACACAGAGGATGACTCAAACCCATCGTCCTACGGTGTATCTCCTTGTAGG
GAAGATTGAGGAGGGTATCATTTTAGTAAATCAGATTTATCACTGGCAGAGGAGGGACTCCCAGCTGACTTTGGCCACT
CAGAAGTGGAGGTACC
CitationWittler L, Saborowski M, Kessel M. Expression of the chick Sizzled gene in progenitors of the cardiac outflow tract. Gene Expr Patterns. 2008 Jul;8(6):471-6. Epub 2008 Feb 29.
CopyrightCopyright © 2008 Elsevier B.V.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Wittler et al. 2008.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 1
stage 3
stage 3
Hypoblast
 
4-6
stage 4
stage 5
stage 5
stage 5
stage 5
stage 5
stage 6
stage 6
stage 6
stage 6
Early Endoderm
Early Mesoderm
Germinal Crescent
Headfold
Primitive Streak
Szl, blue; Chordin, red
Szl, red; Wnt8c, blue
cSzl, blue; Crescent, red
7-12
stage 7
stage 8
stage 8
stage 9
Anterior Intestinal Portal
Early Endoderm
Early Mesoderm
Headfold
Heart
Primitive Streak
Splanchnic Mesoderm
Tail
 
13-18
stage 13
stage 13
stage 14
stage 14
stage 15
stage 16
stage 16
stage 17
stage 17
stage 17
Anterior Intestinal Portal
Cardiovascular
Heart
Outflow Tract
Pharynx
Splanchnic Mesoderm
Tail
 
19-24
stage 21
Outflow Tract
Pharyngeal Arches and Clefts
 
25
stage 25
Cardiovascular
Outflow Tract
 
all
 
 
 
  

Entry 4

GEISHA IdLOC417741.Lee.2020Data SourcePublication
Complete cDNA Template Probeshow
CACGGCAAGCTGGGACTCACAGGGAGATGCTGTTGACTGCAAAAATACTTGTTTTCACTCTGAGTGTTTTCCTAGGAGT
GGGCACAAGTTTTGACATTGGATTATCCACCAAATGTGTAGTGATACCCAAGGAGATGGACATGTGCCACGAGATTGGG
TACTCCGAAATGAGGCTTCCCAACCTGATGGGACACACAAGCATGGCAGAGGTCGTCCTAAAATCCACCACCTGGCAGC
ACCTGGTGCACACGGACTGTCACCCTCATGTGAGGATGTTCCTGTGCTCTCTGTTTGCACCCATCTGCCTGGACACGTT
CATCCATCCCTGTAGGAGTATGTGTGTNGGTGTTCGGGACAGCTGTGCGCCTATACTTGCCTGCCATGGGCACACCTGG
CCAGAAAGTCTGGACTGCAACCGGTTCCCTGCAGACGAGGACATGTGTCTGGCATCGCTTACAAAGGAATACAAATACT
TGCACAAAGTCCTACCGAAGCCTGCATGCCAGACCTGCCCAGCAGTGGAGGAACTCTTCACGCACAAAAGACTTCTCGA
AGTTTTCTGTGACAGTAATTTCGCAGTGAAAGTAAAGCTGTCCAAAAAAAGAGCAGTAATCGGCGACCAAGAGTACAGC
ATTGAGTGCCATGTGGAATTCATTACCCAGGGCTCACTCTTGCCTTATGAAAACTCAGCACATGATAACAGCAAATGGC
TGCTCATCAATGAAAAACTGTACACAGAGGATTGACTCAATACCCATCGTCCTACCGGGTATCTCCTTGTAGGGAAC
CitationHyung Chul Lee, Hui-Chun Lu, Mark Turmaine, Nidia M. M. Oliveira, Youwen Yang† , Irene De Almeida and Claudio D. Stern. Molecular anatomy of the pre-primitive streak chick embryo Open Biol. null. 10.1098/rsob.190299.
CopyrightCopyright © 2020 The Authors.
CommentsThe complete cDNA template sequence was obtained from the information provided in the publication as described in Lee et al. 2020. The probe was synthesized from cDNA clone ChEST714o24.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
X-XIV
stage X
stage XII
stage XII
stage XII
stage XIV
Hypoblast
Stage EGK X-XI
Stage EGK XII-XIII
Stage EGK XIII-XIV
all
 
  

Entry 5

GEISHA IdLOC417741.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
CACGGCAAGCTGGGACTCACAGGGAGATGCTGTTGACTGCAAAAATACTTGTTTTCACTCTGAGTGTTTTCCTAGGAGT
GGGCACAAGTTTTGACATTGGATTATCCACCAAATGTGTAGTGATACCCAAGGAGATGGACATGTGCCACGAGATTGGG
TACTCCGAAATGAGGCTTCCCAACCTGATGGGACACACAAGCATGGCAGAGGTCGTCCTAAAATCCACCACCTGGCAGC
ACCTGGTGCACACGGACTGTCACCCTCATGTGAGGATGTTCCTGTGCTCTCTGTTTGCACCCATCTGCCTGGACACGTT
CATCCATCCCTGTAGGAGTATGTGTGTNGGTGTTCGGGACAGCTGTGCGCCTATACTTGCCTGCCATGGGCACACCTGG
CCAGAAAGTCTGGACTGCAACCGGTTCCCTGCAGACGAGGACATGTGTCTGGCATCGCTTACAAAGGAATACAAATACT
TGCACAAAGTCCTACCGAAGCCTGCATGCCAGACCTGCCCAGCAGTGGAGGAACTCTTCACGCACAAAAGACTTCTCGA
AGTTTTCTGTGACAGTAATTTCGCAGTGAAAGTAAAGCTGTCCAAAAAAAGAGCAGTAATCGGCGACCAAGAGTACAGC
ATTGAGTGCCATGTGGAATTCATTACCCAGGGCTCACTCTTGCCTTATGAAAACTCAGCACATGATAACAGCAAATGGC
TGCTCATCAATGAAAAACTGTACACAGAGGATTGACTCAATACCCATCGTCCTACCGGGTATCTCCTTGTAGGGAAC
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Heart
 

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase482076

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-030530-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona