|
BTG4 BTG anti-proliferation factor 4Gene | Official Symbol | BTG4 | Official Full Name | BTG anti-proliferation factor 4 | CGNC ID | 5750 | also known as | protein BTG4|B-cell translocation gene 4 | gene type | protein-coding |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | BTG4.Elis.2008 | Data Source | Publication | Complete cDNA Template Probe | show TTGGGTGTTTTTGGGAGGAGTTTTCCTATGTTTTGTTCTTCCTTTTTTAATTAAAAAAAAAAAAGCAAGTAAAAGCTAT ATAGGTTTTTGTAACATTAAATCTCTTTCTTCTGTGGCTATCTGAAGTTGTATGTGAAGTATATTTCAGGTTTTCAACA ACTTTGGTCTGAGAAGCAGTTGAAGCACT | Citation | Elis S, Batellier F, Couty I, Balzergue S, Martin-Magniette ML, Monget P, Blesbois E, Govoroun . Search for the genes involved in oocyte maturation and early embryo development in the hen. BMC Genomics. 2008; 9: 110. | Copyright | Copyright © 2008 Elis et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. | Comments | Authors indicated probes were isolated using primers forward: TTGGGTGTTTTTGGGAGG and reverse:AGTGCTTCAACTGCTTCTCAGACC obtained from NCBI (acc #NM_001278123) |
Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | 31-44 |
![](http://geisha.arizona.edu/geisha/photos/thumbs/BTG4.Elis.2008.Fig.10 btg4.png) | stage 44 | ![](http://geisha.arizona.edu/geisha/photos/thumbs/BTG4.Elis.2008.Fig.10.png) | stage 44 | | Ovary
|
| Data from NCBI Unigene EST Profile Unigene ID: Gga.5597 |
MouseFrogFruit FlyZebra FinchZebrafish
|
|