Quick Search
X XI XII XIII XIV 1 2 3 4 5 6 7 8 9 10 11 12
13 14 15 16 17 18 19 20 21 22 23 24
25 26 27 28 29 30 31 32 33 34 35 36
37 38 38 40 41 42 43 44
Gene Family QuickSearch
Human Disease Gene Search
ERBB2 The human orthologue of this gene is associated
Gene Summary Expression Transcript Levels Other Species Expression JBrowse Gene Official Symbol ERBB2 Official Full Name erb-b2 receptor tyrosine kinase 2 CGNC ID 13679 also known as receptor tyrosine-protein kinase erbB-2|v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2|v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog gene type protein-coding
Genomic Map Sequence Information Gene Expression Orthology Gene Ontology Molecular Function Biological Process Cellular Component
Links to other databases
GEISHA Id ERBB2.Abraira.2010 Data Source Publication Complete cDNA Template Probe show CTGCGTTGTCATCCGTGGCGTTGTGCTGCACAAAGTGAGCGGGGGATGGGGACCCCGGTTGGGACGTGGGGGGGGGACG
Citation Abraira VE, Satoh T, Fekete DM, Goodrich LV. Vertebrate Lrig3-ErbB interactions occur in vitro but are unlikely to play a role in Lrig3-dependent inner ear morphogenesis. Dev Biol. 2010 Apr 15;340(2):595-604. Epub 2010 Feb 18. Copyright Copyright Abraira et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Comments As insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_001044661.1).
Stage Image (click image to view full size) Location (click to highlight) Comments (click to highlight) 25-28
stage 28
stage 28
Ear/Otic Placode
Data from NCBI Unigene EST ProfileGga.23927
Mouse Frog Fruit Fly Zebra Finch Zebrafish
